What is it in the cell that is capable of storing data ?


Craig Venter unveils "synthetic life" | Video on TED.com
COLD SPRING, N.Y.— J. Craig Venter and his colleagues recently announced that they had created the first cell to run on a fully artificial genome. So what's next for this synthetic strain of microscopic Mycoplasma mycoides and the new technology?
The "synthetic cell" achievement has been lauded, condemned and undercut, but it has yet to fully demystify life's underlying code, the genome. "It's amazing how little we know about genomics," Venter said June 1 at the Cold Spring Harbor Symposia on Quantitative Biology in Cold Spring, N.Y.
Researchers built much of the bacterium's genome without fully understanding the function of many of the million-plus base pairs involved. About half of the genes, in fact, are still "a complete black box," said Richard Roberts of New England Biolabs, Inc., in a commentary after Venter's talk.
But a bit like complex erector sets can help illuminate some of the basic rules of physics and engineering, scientists are hoping that constructing—and deconstructing and reconstructing—whole genomes will help them better understand genomic principles. "We have to find what the rules are," Roberts said. Scientists, for instance, don't yet know what role or importance the order of genes in the genome plays. They have seen that in some cases, genes can have their order swapped with little visible outcome on life, whereas, specific sequence might be more important elsewhere on the genome.
Although the researchers based their synthetic genome on the natural one, their cell did not behave exactly the same, Venter noted. Usually when you mess around with the inner workings of a cell, especially its genetic code, growth rate tends to slow. With this one, however, there was a substantial increase in the growth rate. "That was a surprise," Venter said. "We have no idea why the cells grew faster."
Future studies will examine the behavior of the microbe and its progeny to see how these behavioral changes match up to genetic changes. The initial paper was only intended as a proof of concept, Venter pointed out. Nevertheless, he said, "people are disappointed that it doesn't sing and dance."
So how long will it be until scientists can synthesize genomes for other, more complex forms of life? Even expanding the capability to various kinds of bacteria will likely take a long time, Roberts noted. "Maybe we'll even be able to take the Jurassic Park scenario," but he said, happily, that there wasn't much chance of crossing paths with a recreated dinosaur—in his lifetime anyway.
One of the group's long-term goals, said Venter (who has "never been known for his extreme modesty," Roberts, a long-time acquaintance, said at the symposium), is to develop a universal recipient cell, into which researchers can plug a variety of synthetic genomes and see how they run. And in the future, he proposed, it might be cheaper for scientists to synthesize simple organisms than to grow them.
Roberts is happy to see the synthetic genome advance as a way to refocus research interest and attention on bacteria, which he calls "cute…lovely little organisms." In particular, being able to better understand the genomes of bacteria can have broad health implications for people, who host some 100 trillion microbial cells in and on their bodies.
The field of genomics, however, can be slow-going and riddled with many costly mistakes. Just one error small in earlier attempts to assemble a synthetic code set the researchers on Venter's team back months. But James Watson, former head of Cold Spring Harbor Laboratory whose co-discovery of DNA more than 50 years ago helped to lay the foundation for this work, was pleased by the speed of progress. "We've been so much more successful that you might have predicted," he said at the symposium.
And for those keeping score, the synthetic genome, which contains coded Web and email addresses, has been cracked by 26—and counting—scientists so far, Venter said on Tuesday.
Coarse edged youth, the irish pendants string from their smiles
not yet plucked as to slacken the seams
and drag down the features of age,
no folds or creases from unkempt wear
eyes of tranquilty, crystalline-beads
no sign of despair in their hair, nor their hearts
but oh they have yet to be experienced and that makes aging so very worth it...ML circa2012
What is it in the cell that is capable of storing data ?
" A cookie without sugar is just a cracker" ~ ancient voodoo proverb
"A man with infinite patience is never left waiting."~ROID's past incarnation
NOW AVAILABLE!!!
Super-DMZ Rx™ Pro-Hormone (Superdrol Dymethazine)
ASIA PHARMA GMP
BRITISH DRAGON GMP
FREE SAMPLES
OFFER AND KITS- BUY 1 GET 1 FREE
We're killing ourselves and now we're replacing ourselves.
Disclaimer: All health, fitness, diet, nutrition, anabolic steroid & supplement information posted here is intended for educational and informational purposes only, and is not intended as a substitute for proper medical advice from a medical doctor. We do not condone the use of anabolic steroids (AAS), all information about AAS is for educational and entertainment purposes only. If you choose to use AAS it's your responsibility to know the laws of the country that you live in. Consult your physician or health care professional before performing any of the exercises, or following any diet, nutrition or supplement advice described on this website.
Juggernaut Journal -my quest to be intimidating
Co-Owner Beyond Nutrition
Like us on


careful down daddy
Don't look back ~ You're not going that way!


Coarse edged youth, the irish pendants string from their smiles
not yet plucked as to slacken the seams
and drag down the features of age,
no folds or creases from unkempt wear
eyes of tranquilty, crystalline-beads
no sign of despair in their hair, nor their hearts
but oh they have yet to be experienced and that makes aging so very worth it...ML circa2012
what format is it stored in ?
abaabbbbababbababba
or 01100010001001000 ?
this is serious question
" A cookie without sugar is just a cracker" ~ ancient voodoo proverb
"A man with infinite patience is never left waiting."~ROID's past incarnation
NOW AVAILABLE!!!
Super-DMZ Rx™ Pro-Hormone (Superdrol Dymethazine)
ASIA PHARMA GMP
BRITISH DRAGON GMP
FREE SAMPLES
OFFER AND KITS- BUY 1 GET 1 FREE


ATGCATCGATTGAGCTCTAGCG
TAGCTAACTCGAGATCGC, you know the Gentic Code, Base Pairs
Yeah in the Computer it was binary but the actual cell is built two Nucleotides at a time just like you or me, well your's screwed up around the 21st chromosome with that copy it made but we can't blame your sibling parents for that.....
Coarse edged youth, the irish pendants string from their smiles
not yet plucked as to slacken the seams
and drag down the features of age,
no folds or creases from unkempt wear
eyes of tranquilty, crystalline-beads
no sign of despair in their hair, nor their hearts
but oh they have yet to be experienced and that makes aging so very worth it...ML circa2012


They say this discovery may make it possible for us to engineer algae that thrives on greenhouse gases or bacteria that breakdown plastics..so they can help to save the planet as we continue to infest it at alarming rates.....it only takes a day to build these little guys which is awesome, it took month's or years doing it the old fashioned way of cultivating them....
What I think will be great is when we get to building internal organs like a heart or a new limb or repair the first spinal cord.....
Coarse edged youth, the irish pendants string from their smiles
not yet plucked as to slacken the seams
and drag down the features of age,
no folds or creases from unkempt wear
eyes of tranquilty, crystalline-beads
no sign of despair in their hair, nor their hearts
but oh they have yet to be experienced and that makes aging so very worth it...ML circa2012
I am not ashamed to admit that this is beyond my sphere of understanding, but what rudiments I can grasp seem to say that this is intended to lead to creating cellular life with specific function?
Thats outstanding.
First cycle log DOOM!http://www.ironmagazineforums.com/an...cycle-log.html


Yes, mass production of vaccines in a a shorter amount of time. Venter say's in a day or two what used to take month's...
Genomics is fascinating I've been watching this stuff develop since I first heard about the Human Genome Project, I was in school back then so my mind was primed to absorb all that stuff. I've been watching it since and when they finished the sequencing in 2007 I thought it was on...but now that they have successfully simulated life I am really excited....
The other field I really find appealing is Proteomics or the Protein-ome, it's more complicated but gives an even better understanding of organisms and disease....your genes remain pretty much the same through life, but proteins vary throughout it....understanding the specific functions of each protein may lead to us not dying from disease, living much longer lives, etc.....
Coarse edged youth, the irish pendants string from their smiles
not yet plucked as to slacken the seams
and drag down the features of age,
no folds or creases from unkempt wear
eyes of tranquilty, crystalline-beads
no sign of despair in their hair, nor their hearts
but oh they have yet to be experienced and that makes aging so very worth it...ML circa2012
DISCLAIMER: